Visar bild 1 av
1
LexA | LexA repressor (protein, positive control)
Product no: AS21 4541P
AS21 4541P | Protein/positive control for Western blot
459
€
Delivery:
3-6 business days
- Product Info
-
Purity: Contains 50% glycerol, 10 mM Tris-HCl (pH 7.5), 2 mM EDTA, 100 mM NaCl, 1 mM DTT. Over 90% pure by SDS-PAGE. Format: Liquid Quantity: 20 µg Storage: Store at -20°C or -80°C for a longer period of time; once make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube. Tested applications: Western blot (WB) Expected | apparent MW: 22.3 | 23 kDa - Application Examples
-
5 and 2 µg of highly purified LexA protein from Escherichia coli was separated on SDS-PAGE and stained by Coomasie. - Additional Information
-
Additional information: This product can be used in:
- Functional studies of E.coli SOS response. This product will bind to SOS box in vitro and repress the expression of the genes belonging to SOS regulation
- Western blot as a positive control, to confirm that the bait construct is expressed in yeast two-hybrid sstem using lexA gene
- control in ChIP in combination with anti-LexA antibodies
Additional information (application): LexA protein is full-length, highly purified (over 90%, SDS-PAGE) provided at a concentration of 1 mg/ml estimated by BCA method. UniProt: P0A7C2 - Functional studies of E.coli SOS response. This product will bind to SOS box in vitro and repress the expression of the genes belonging to SOS regulation
- Background
-
Background: Escherichia coli LexA protein inhibits the transcription of the genes belonging to the SOS regulon that are related to DNA repair and cell division by recognizing and binding to the SOS-box sequence (TACTGTATATATATACAGTA). LexA‘s self-protease activity is promoted by RecA protein which, responding to DNA damage, is activated by its binding to single-strand DNA accumulated in the cells. It is cleaved into two fragments and loses its function as a repressor. As a result, the expression of genes belonging to the S - Protocols
-
Agrisera Western Blot protocol and video tutorials
- Reviews:
-
This product doesn't have any reviews.
Accessories
AS09 602 | Clonality: Polyclonal | Host: Goat | Reactivity: Rabbit IgG (H&L)
213 €
AS21 4542 | Clonality: Polyclonal | Host: Rabbit | Reactivity: Escherichia coli
344 €
AS21 4541 | Clonality: Polyclonal | Host: Rabbit | Reactivity: Escherichia coli
361 €